NNNs Finder

  1. The two sequences must have identical length. Ex. seq1; AGTGCGATCGTGATCGACTG, seq2; AGTGCGATCGTTATCGACTG.
  2. The sequence size must be limited under 255 nucleotide.
  3. The two sequences must have one single nucleotide polymorphism.
  4. 'The SNP must not be located on the top or end of the two sequences.